Chromosomal mapping of the tankyrase gene in human and mouse.

نویسندگان

  • L Zhu
  • S Smith
  • T de Lange
  • M F Seldin
چکیده

Functional gene description: Tankyrase (TNKS) is a ovel gene with homology to both ankyrins and the cataytic domain of poly(ADP-ribose) polymerase (PARP) that as recently cloned using a yeast two-hybrid screen with he telomere-specific DNA binding protein TRF1 (1). ankyrase protein is located at telomeres, centrosomes, nd nuclear pore complexes (1; S. Smith and T. de Lange, n preparation). In vitro studies have demonstrated that ankyrase has PARP activity and that both tankyrase and RF1 can function as acceptors for ADP ribosylation. Since DP ribosylation of TRF1 decreases its telomeric DNA inding activity in vitro, the TNKS gene may function by odulating telomere length. Description of clone or DNA: For human TNKS maping, a PCR specific for the TNKS gene was utilized. The rimers (forward, 59CGAAGTGCTAGGGGAGTCCG; reerse, 59GTGGGAGAGGCTGGG GTGGT) amplified a 69-bp fragment from the TNKS gene (Accession No. FO82556). For mouse Tnks mapping, a mouse EST (Accesion No. AA415426) that had 98% sequence homology with uman TNKS was used. Source: The source of cDNA, as described above, was equence from a human cDNA clone and a mouse cDNA lone. Method used to validate gene identity: Gene identity as validated by specific amplification and, for the mouse ST, stringent hybridization to a single disparate-sized retriction fragment in the two species of mouse used in the apping panel.

برای دانلود رایگان متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید

ثبت نام

اگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید

منابع مشابه

Chromosomal Variation in Three Human-Mouse Hybridoma Cell Lines after Various Passaging Intervals as Assessed with Two Different Staining Methods

Objective(s) The main objective of this study was to investigate the status of chromosome stability in 3 human-mouse hybridoma cell lines over a period of time in various passages. Materials and Methods Metaphase spreads from 3 human-mouse cell lines (HF2X653, SPMO-4 and F3B6) that had been cultured in 4 successive passages, from 1 to 4 weeks, were prepared and analyzed. Metaphase chromosome...

متن کامل

P-230: Analysis of TEX15 Expression in Testis Tissues of Severe Oligozoospermic and Non-Obstructive Azoospermic Men Referred to Royan Institute

Background: TEX15 is a novel protein that is required for chromosomal synapsis and meiotic recombination. Human TEX15 is located on chromosome 8(8p12 region) and expressed in testis and ovary, as is its mouse ortholog. Loss of TEX15 function in mice causes early meiotic arrest in males but not in females. Specifically, TEX15 deficient spermatocytes exhibit a failure in chromosomal synapsis. In ...

متن کامل

P-111: An Attempt to Facilitate the Production of Transgenic Mouse As A Model for Gene Therapy of Gaucher Disease

Background: Gaucher disease is an autosomal recessive inherited lysosomal storage disorder that affects many of the body's organs and tissues by defective function of the catabolic enzyme β-glucocerebrosidase. Gene therapy is one of the efficient ways for treatment of this disease. Due to the lack of appropriate animal models, in the field of gene therapy little progress has been done.Mate...

متن کامل

I-13: Transcriptome Dynamics of Human and Mouse Preimplantation Embryos Revealed by Single Cell RNA-Sequencing

Background: Mammalian preimplantation development is a complex process involving dramatic changes in the transcriptional architecture. However, it is still unclear about the crucial transcriptional network and key hub genes that regulate the proceeding of preimplantation embryos. Materials and Methods: Through single-cell RNAsequencing (RNA-seq) of both human and mouse preimplantation embryos, ...

متن کامل

P-229: Chromosomal Analysis of Parthenogenetic Mouse Embryos Generated from In Vitro Activated Oocytes by Hydrostatic Pressure and Ethanol and Cytochalasin B

Background: Studies of preimplantation stage embryos by classic cytogenetic techniques have limitations, starting with the need for good metaphase stage when only one third of all analyzed embryos may show good quality metaphases. The incidence of chromosome anomalies in embryos produced by in vitro procedures is generally higher than that of embryos formed in vivo. Pressure specifically affect...

متن کامل

ذخیره در منابع من


  با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید

عنوان ژورنال:
  • Genomics

دوره 57 2  شماره 

صفحات  -

تاریخ انتشار 1999